You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
gltT [2019-01-08 10:36:26]
major high-affinity Na+-coupled glutamate/ aspartate symport protein
Molecular weight
45.76 kDa
Function
glutamate and aspartate uptake
Product
major Na+-coupled glutamate/ aspartate symport protein
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,096,560 → 1,097,849
Phenotypes of a mutant
impaired uptake of glutamate and aspartate PubMed The protein
Protein family
Paralogous protein(s)
Kinetic information
Km values: 37 ± 5 μM for glutamate, 41 ± 9 μM for aspartate PubMed Effectors of protein activity
aspartate uptake is competitively inhibited by glutamate PubMed Structure
4IZM (the protein from Pyrococcus horikoshii, 35% identity, 73% similarity) PubMed4KY0 (the glutamate transporter of Thermococcus kodakarensis, 35% identity, 72% similarity) PubMed Localization
Expression and Regulation
Biological materials
Mutant
BP233 (ΔgltT::spc), available in Fabian Commichau's labBP235 (ΔgltT::spc ΔgltP::cat), available in Fabian Commichau's labGP2247 (ΔgltT::ermC), available in Jörg Stülke's labGP2248 (ΔgltT::aphA3), available in Jörg Stülke's labGP2722 (ΔgltT::zeo), available in Jörg Stülke's labBKE10220 (ΔgltT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGATTACCTCCCAAAAA, downstream forward: _UP4_TAATGAAAAGCCTGCGGGGTBKK10220 (ΔgltT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGATTACCTCCCAAAAA, downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT Expression vectors
References
Loading